rs4360494 chr1:37990219 G>C
- Sequence
cgagaggttcgcagatgcctccag[G/C]gggcataggaaaacccaagaacct
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN JUN_HUMAN CDN1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.50 | 0.21 | 1.42 | -5.00 | Concordant | |||
| RAD21_HUMAN | 2.07 | -0.56 | 1.32 | n/a | n/a | |||
| JUN_HUMAN | 1.87 | 0.25 | 1.23 | n/a | No Hit | |||
| CDN1B_HUMAN | 1.93 | -1.41 | 1.25 | n/a | n/a | |||
| SNAI2_HUMAN | n/a | 3.60 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 26
Motif analysis
Genetic associations
EMBL-EBI colorectal cancer or advanced adenoma, heel bone mineral density, height, pulse pressure, red cell distribution width
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood