rs4364871 chr1:41003732 C>T
- Sequence
aatgctcagataatatcagctctt[C/T]gcctagctgtgtattactatgtga
- ASB in cell types
- foreskin keratinocyte 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.56 | -3.20 | 2.11 | |||
| 22RV1 (prostate carcinoma) | 2.41 | -0.13 | 2.00 |
Items per page:
1 – 2 of 2