rs4400499 chr9:136410589 C>T
- Sequence
gagcaccgaaagcgcgtgcctgaa[C/T]gccttgggccgtcggcgaggggga
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) HCT-116 (colon carcinoma) upper lobe of left lung SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- MAX_HUMAN FLI1_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAX_HUMAN | 1.79 | 0.49 | 1.21 | n/a | No Hit | |||
| FLI1_HUMAN | -1.74 | 2.29 | 1.00 | n/a | No Hit | |||
| EP300_HUMAN | 1.96 | 0.59 | 1.26 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood