rs4448 chr22:32881012 G>A
- Sequence
gcagaggggttagccctcacccac[G/A]tggtggcctggggcagccctgctc
- ASB in cell types
- NCI-H2171 (small cell lung carcinoma)
- ASB for transcription factors
- MYC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYC_HUMAN | 2.61 | 0.12 | 1.25 | -5.06 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
