rs4482973 chr6:47246123 G>T
- Sequence
cccaaaccatatcactatcttaat[G/T]agaatatacccacctatacttctc
- ASB in cell types
- monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocytes from periferal blood | 2.21 | -1.20 | 3.00 |
Items per page:
1 – 1 of 1