rs4568406 chr5:134184258 C>T
- Sequence
cagagttgccatgctgggcccaag[C/T]taaggcagtgacagggacgggatt
- ASB in cell types
- T47D (invasive ductal carcinoma) uterus
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.13 | 0.96 | 2.05 | |||
| uterus | -1.44 | 1.77 | 1.00 |
Items per page:
1 – 2 of 2