rs4573621 chr10:112227790 A>G
- Sequence
cttttggaaccacaaacagtccgg[A/G]tcaatttgttctaaaggctcattg
- ASB in cell types
- adipose hMADS-3 (adipose-derived stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adipose | 1.70 | n/a | 2.50 | |||
| hMADS-3 (adipose-derived stem cells) | -0.86 | 1.79 | 1.00 |
Items per page:
1 – 2 of 2