rs4599384 chr4:48316373 G>A
- Sequence
gttgtcactgggatcccaaaagcc[G/A]tatctgctgcggaactatgttgcc
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.07 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hypertension (early onset hypertension), irritible bowel syndrome, longstanding arthritis, mitral annular calcium, rheumatoid arthritis, spine bone mineral density (bmd), systolic blood pressure (sbp), triglycerides change with statins, waist hip ratio