rs4602278 chr20:1702483 A>G
- Sequence
accctcttcctataccacaacccc[A/G]ctcactcccaggagcagcagctgc
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) J-Lat A72
- ASB for transcription factors
- CDK9_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | -2.11 | 2.59 | 1.00 | n/a | n/a | |||
| SMCA4_HUMAN | n/a | 1.98 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting insulin, hdl cholesterol, homa-b, homa-ir, mitral annular calcium, years of education