rs4607990 chr10:133247132 C>T
- Sequence
ccaggcaccccgccccacttcccc[C/T]gaccaccaggcggccccagagccc
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) MCF7 (Invasive ductal breast carcinoma) RWPE2 GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.20 | 2.05 | 1.56 | 0.22 | Weak Concordant | |||
| STAG1_HUMAN | -0.92 | 1.30 | 1.17 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
