rs4618959 chr1:156383079 G>A
- Sequence
gtgccgagggcagctggggagtcc[G/A]cgaggggtgagcgaggccctctct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HMEC (human mammary epithelial cells) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.25 | 0.93 | 1.10 | |||
| HMEC (human mammary epithelial cells) | 1.75 | -1.44 | 1.00 | |||
| hepatocytes | 0.07 | 1.43 | 1.00 |
Items per page:
1 – 3 of 3