rs4633 chr22:19962712 C>T
- Sequence
caaggagcagcgcatcctgaacca[C/T]gtgctgcagcatgcggagcccggg
- ASB for transcription factors
- MYCN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYCN_HUMAN | 1.40 | 0.04 | 1.39 | -4.43 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP coronary artery disease (cad), irritible bowel syndrome, major depressive disorder (broad definition), major depressive disorder (narrow definition), recurrent early onset major depressive disorder (broad definition), recurrent early onset major depressive disorder (narrow definition), serum creatinine, simpson-angus scale, systolic blood pressure (sbp), total cholesterol, triglycerides
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid, Whole_Blood