rs4635039 chr10:113746357 C>T
- Sequence
tcccttgctgccttccttctgtgg[C/T]attttcctagcaaaaatgctaagc
- ASB in cell types
- BEAS-2B (bronchial epithelium) MDA-MB-231 (breast adenocarcinoma)
- ASB for transcription factors
- GCR_HUMAN GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | -0.24 | 1.59 | 1.00 | n/a | No Hit | |||
| GATA3_HUMAN | -0.32 | 2.01 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid