rs4648999 chr1:24587541 A>T
- Sequence
ttttcttttcttttttttacaggg[A/T]ctcactctgtcacccaggctggag
- ASB in cell types
- transverse colon
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| transverse colon | 0.24 | 1.68 | 1.00 |
Items per page:
1 – 1 of 1