rs4654378 chr1:28882347 A>G
- Sequence
cagctctctcctgcccctccctgc[A/G]aacagcgagtatcgccttcaagtc
- ASB in cell types
- K562 (myelogenous leukemia) OCI-LY7 (diffuse large B-cell lymphoma) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.56 | 0.67 | 1.13 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | -0.96 | 1.65 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | -2.73 | 2.29 | 5.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Testis