rs4660567 chr1:41752236 T>C
- Sequence
ttcaaaaccacagggtgacctctg[T/C]gctgcacctccctggtcagcacac
- ASB in cell types
- monocyte-derived macrophages from peripheral blood AML (monocytes and acute myeloid leukemia) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | -1.22 | 1.51 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, chronic kidney disease, homa-ir, serum creatinine