rs4673821 chr2:214379091 T>C
- Sequence
gacatcagatagcctcttgtgaat[T/C]atccctaaaatgatgggtttcctt
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Ishikawa (endometrial adenocarcinoma) | 1.63 | -0.21 | 1.38 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, alzheimers disease, bipolar disorder, body mass index (bmi), coronary artery disease (cad), hypertension (early onset hypertension), late onset alzheimers disease, paternal transmission distortion, risperidone response in schizophrenia treatment