rs4685984 chr3:5788099 G>C
- Sequence
gggagctccagactaaattgcttt[G/C]tactcttgcatctatgtatgtgtc
- ASB in cell types
- HeLa (cervical adenocarcinoma) monocyte-derived dendritic cells
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.54 | 1.09 | 1.20 | n/a | No Hit |
Items per page:
1 – 1 of 1