rs4689953 chr4:4851742 C>G
- Sequence
aggataagcaccaagtgggggctg[C/G]aaaacctgcacttagtatcagttc
- ASB in cell types
- bipolar neuron
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 2.17 | -2.16 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1