rs4701195 chr5:179698397 C>G
- Sequence
atgactctgcaggaactgcggcgc[C/G]ggctcacacagcgcggagcagtgc
- ASB in cell types
- A549 (lung carcinoma) monocytes from periferal blood GM12878 (female B-cells lymphoblastoid cell line) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.02 | 1.36 | 2.00 | |||
| monocytes from periferal blood | 2.54 | n/a | 3.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 2.30 | n/a | 1.50 | |||
| VCaP (prostate carcinoma) | 1.26 | 0.13 | 2.38 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid