rs470221 chr11:102794539 T>C
- Sequence
tcttctttgaagagggaagcacca[T/C]gttgtggctgcccctatctgtccc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.34 | 1.12 | 1.09 | |||
| glioblastoma cells | -3.37 | 1.81 | 1.50 |
Items per page:
1 – 2 of 2