rs4714358 chr6:40673657 C>A
- Sequence
tattggtaaaatgttttcaacagc[C/A]aacacaacaggacacacgccagaa
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.26 | 0.17 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 1.00 | 0.34 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hdl cholesterol, suicide attempts in major depressive disorder, suicide attempts in mood disorder patients