rs4714567 chr6:12430198 A>C
- Sequence
ttgcttattcaataggccactcaa[A/C]tccatagcttcttcttttgtaatg
- ASB for transcription factors
- NANOG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NANOG_HUMAN | -2.22 | 2.19 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), irritible bowel syndrome, lp-pla2 mass, systolic blood pressure (sbp), triglycerides change with statins