rs4733610 chr8:128437979 G>T
- Sequence
ctagtattctaattaatggtgtgt[G/T]aataataatattatcttttaacat
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.93 | -1.16 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, ldl cholesterol, rheumatoid arthritis, type 2 diabetes, urinary albumin-to-creatinine ratio, waist hip ratio, years of education