rs4740438 chr9:131336615 G>A
- Sequence
gagacccattcccttccctttgga[G/A]gctcaaagggcagcactgcctggt
- ASB in cell types
- foreskin keratinocyte GM12890 (Lymphoblastoid Cell Lines) KMS-11 (Plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.45 | 0.82 | 1.20 | -3.98 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP chronic kidney disease, fasting insulin, general white matter integrity factor, homa-b, homa-ir, hypertension (early onset hypertension), longstanding arthritis, rheumatoid arthritis, stabilized warfarin dose, transmission distortion, triglycerides