rs4749126 chr10:26438753 C>A
- Sequence
gacagcacttcctccccggggcag[C/A]gacctggagcccgggtgcggcagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.89 | 0.41 | 1.17 | |||
| GM02630 (Fanconi anemi) | 1.65 | -0.67 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Vagina, Whole_Blood