rs4750482 chr10:14185551 G>A
- Sequence
aactatggaaacttgaaacataaa[G/A]caagactatttaaaggttcaatct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MOLT-4 (Adult T acute lymphoblastic leukemia) WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- REL_HUMAN SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REL_HUMAN | 2.53 | -2.23 | 1.00 | n/a | No Hit | |||
| SPT5H_HUMAN | 1.24 | 0.01 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2