rs4780377 chr16:11458608 G>C
- Sequence
tagaatggtgctttccagggactg[G/C]gagaaggagagaatggggagtcag
- ASB in cell types
- K562 (myelogenous leukemia) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.33 | 1.34 | 2.00 | |||
| MDM(monocyte derived macrophages) | 2.48 | -0.75 | 3.33 |
Items per page:
1 – 2 of 2