rs4790371 chr17:2848663 G>A
- Sequence
gagtaactggtattccaagcgccc[G/A]ccaccacgcctggatgattttcgt
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 1.95 | -0.41 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 1.45 | -1.25 | 1.00 |
Items per page:
1 – 2 of 2