rs4796165 chr17:36134092 A>G
- Sequence
ttgtactggtcatggctacctttt[A/G]caagtccatcagctgtttttcaat
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- FEZF1_HUMAN ZN510_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FEZF1_HUMAN | -1.20 | 1.85 | 1.75 | n/a | No Hit | |||
| ZN510_HUMAN | n/a | 2.76 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, systolic blood pressure (sbp), triglycerides change with statins, urinary albumin-to-creatinine ratio