rs4804476 chr19:9931200 A>G
- Sequence
agaacatcgtcttacccctaaaca[A/G]cagtgccctatcggtggaatgtca
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.76 | 0.03 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.74 | -0.03 | 1.98 | |||
| bipolar neuron | -0.48 | 1.28 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood