rs4809324 chr20:63686867 T>C
- Sequence
agattccaagggcctggaatctgt[T/C]tgttccattgacctctgatgtcac
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.64 | 0.34 | 2.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, coronary artery disease (cad), glioma (glioblastoma), glioma (high-grade glioma), high-grade glioma, obesity with early age of onset (age >2), premature ovarian failure, spine bone mineral density (bmd)
PheWAS abnormal findings on radiological examination intrathoracic organs, abnormal weight gain, adverse drug events and drug allergies, adverse effects of cardiac rhythm regulators, allergic rhinitis, aphakia and other disorders of lens, aseptic necrosis of bone, asthma with exacerbation, benign neoplasm of respiratory and intrathoracic organs, bronchitis, bundle branch block, chronic lymphocytic thyroiditis, chronic pharyngitis and nasopharyngitis, chronic sinusitis, decubitus ulcer, deficiency of humoral immunity, deviated nasal septum, diseases of the tongue, disorders of external ear, dupuytrens disease, failure to thrive, fibroadenosis of breast, fluid overload, fracture of hand or wrist, fracture of unspecified bones, frequency of urination and polyuria, gastritis and duodenitis, generalized hyperhidrosis, hypertensive chronic kidney disease, intestinal infection, intestinal obstruction without mention of hernia, lack of normal physiological development, left bundle branch block, lesions of stomach and duodenum, liver abscess and sequelae of chronic liver disease, macular degeneration, wet, magnesium metabolism disorder, nasal polyps, nervous system congenital anomalies, open wound of ear, open wound of hand except finger(s), osteochondropathies, other congenital anomalies, other dermatoses, other intestinal obstruction, other specified diseases of the salivary glands, other specified gastritis, polymyalgia rheumatica, polyp of corpus uteri, polyp of female genital organs, postlaminectomy syndrome, postmenopausal bleeding, primary thrombocytopenia, prolapse of vaginal walls, retinal edema and hypertensive retinopathy, seborheic dermatitis, symptoms involving nervous and musculoskeletal systems, symptoms/disorders of the urinary system, urinary incontinence
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood