rs4812818 chr20:44310786 T>G
- Sequence
tgcccaaagtgggtctgcaaacac[T/G]aactgctagtgacaccagctaccc
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
- ASB for transcription factors
- PRD10_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | 2.50 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Transverse, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood