rs4813653 chr20:4064782 A>G
- Sequence
agggcactgggcttcgggccagcc[A/G]gggcctgggaggagctgctggaaa
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN SUH_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.86 | n/a | 2.33 | n/a | No Hit | |||
| SUH_HUMAN | 2.56 | -0.23 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP pci (rim area, superotemporal rim area, inferotemporal rim area, rim-to-disc area ratio, and linear cup-to-disc ratio) , college completion, inferotemporal rim area, major depressive disorder (broad definition), major depressive disorder (broad definition) (females)
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Colon_Sigmoid, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid