rs4821073 chr22:32562655 A>C
- Sequence
accctactccgttttctgcccaac[A/C]ggagaataaaggaagcatcagagc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- GATA3_HUMAN ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -4.94 | 2.87 | 2.00 | n/a | No Hit | |||
| ELF1_HUMAN | -1.62 | 2.55 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), neuroblastoma (brain cancer), neuroticism, partial epilepsy, tetrology of fallot, triglycerides