rs4836064 chr5:124180036 G>A
- Sequence
tactattacatttagcctacccac[G/A]caaattggtcccagcagttttctc
- ASB in cell types
- HEK293T (embryonic kidney)
- ASB for transcription factors
- PKNX1_HUMAN ZN384_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 3.51 | n/a | 2.00 | n/a | No Hit | |||
| ZN384_HUMAN | 2.14 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, fasting insulin, homa-ir, hypertension (early onset hypertension), parkinsons disease, total cholesterol change with statins, waist hip ratio