rs4839549 chr1:110634615 G>A
- Sequence
cctctgtaatgcacttggcaatga[G/A]ctgatgctctttagtggtagttgt
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 1.26 | 0.45 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hdl cholesterol, infant head circumference, ldl cholesterol, total cholesterol, total cholesterol change with statins