rs4850687 chr2:196250030 A>G
- Sequence
ctcagccacatttagagtgctcat[A/G]cagtcttgaagaatgtgtgcagtc
- ASB in cell types
- MDM(monocyte derived macrophages) upper lobe of left lung
- ASB for transcription factors
- SPI1_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.80 | 2.02 | 1.53 | n/a | No Hit | |||
| EP300_HUMAN | 2.77 | -5.29 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood