rs4853479 chr2:191571433 T>C
- Sequence
ttgggttttttgtggggttttttt[T/C]ctggtcattaaagttgcaaatatg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | n/a | 2.19 | 1.00 | |||
| A549 (lung carcinoma) | 0.94 | 0.15 | 2.03 |
Items per page:
1 – 2 of 2