rs485618 chr1:160830690 T>C
- Sequence
tgtgctctgggtgatttttctact[T/C]agagatgggcttgctttgcaccat
- ASB in cell types
- A549 (lung carcinoma) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.91 | 0.24 | 2.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.88 | 0.70 | 1.11 |
Items per page:
1 – 2 of 2