rs486476 chr11:116442209 C>G
- Sequence
aataagcatgaactccaagtgatg[C/G]aggcaaacccaaaaattggggctt
- ASB for transcription factors
- ZN682_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN682_HUMAN | 1.37 | -3.29 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol, parkinsons disease, years of education