rs4872390 chr8:26053459 G>A
- Sequence
agccaccagcaggtttggcccagt[G/A]gattgcaaagtagaagcttttcca
- ASB in cell types
- THP-1 (acute monocytic leukemia) HDF(human dermal fibroblasts)
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | -0.23 | 2.01 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, college completion, irritible bowel syndrome, mitral annular calcium, stabilized warfarin dose, years of education