rs4883520 chr12:132538819 T>C
- Sequence
aactgaatttgctgagtaagcaaa[T/C]atagcatttttcttcaggacccac
- ASB for transcription factors
- MAFK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFK_HUMAN | 2.74 | -4.97 | 2.00 | -2.87 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP fasting insulin, homa-b, homa-ir, irritible bowel syndrome, total cholesterol, triglycerides, type 2 diabetes
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cortex, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid