rs4893 chr19:48330351 A>G
- Sequence
atctatgccattcacgccgaggag[A/G]tcctggagaagcacccgcgagggg
- ASB in cell types
- neural cell NB69 (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 1.12 | 0.06 | 1.00 | |||
| NB69 (neuroblastoma) | -1.16 | 1.85 | 1.17 |
Items per page:
1 – 2 of 2