rs4905137 chr14:93999735 C>G
- Sequence
ctactggctgcaggactgcgacac[C/G]gtgtgtggcctcatggagccacga
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -1.81 | 2.20 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -1.39 | 1.73 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis