rs4908553 chr1:6507189 G>A
- Sequence
agagacctctgccacggtatccac[G/A]tgacctgtgccccagcagggtcat
- ASB in cell types
- MDA-MB-231ERb(triple negative breast cancer)
- ASB for transcription factors
- ESR2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR2_HUMAN | -0.94 | 2.31 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cortex, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood