rs4909716 chr8:137891104 T>C
- Sequence
cctgtggctcaggtcgtccaaaca[T/C]cgagtcctacatctgtgtgcaatc
- ASB in cell types
- foreskin keratinocyte GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.27 | 1.93 | 2.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.33 | 1.26 | 1.17 |
Items per page:
1 – 2 of 2