rs4916014 chr1:64955375 G>A
- Sequence
ggaggggcagaggaagagaccagg[G/A]acatttgaaggggccttgaaagct
- ASB in cell types
- HEK293 (embryonic kidney) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.04 | 0.90 | 1.99 | |||
| upper lobe of left lung | -3.44 | 1.55 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood