rs4916258 chr1:172444386 T>G
- Sequence
ttaagtcaggccctcagctgggac[T/G]tcccgtgcatccatgcgttcattc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines) neural cell
- ASB for transcription factors
- IKZF1_HUMAN STAG1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 2.05 | -1.58 | 1.00 | n/a | No Hit | |||
| STAG1_HUMAN | 1.60 | 0.75 | 1.06 | n/a | n/a | |||
| IKZF2_HUMAN | 1.62 | -0.74 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood