rs4918067 chr10:103884878 A>C
- Sequence
ttctgacctctagtggctgtgtcc[A/C]ctcattactccttccaactgggat
- ASB in cell types
- A549 (lung carcinoma) hepatocytes erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.34 | 0.96 | 2.00 | |||
| hepatocytes | 0.98 | -0.44 | 1.00 | |||
| erythroid progenitors | 1.78 | -4.45 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood